[ExI] Dodged the bullet maybe

[Stuart LaForge]

Quoting Will Steinberg:

> Yeah I doubt that data is legit tbh.

I assume it to be at least as accurate as their flu data which China  
also cherry picks with regard to cause of death. If it can be  
attributed to ANYTHING else, it will be on the death certificate.

> What do y'all think of this:
> https://jameslyonsweiler.com/2020/01/30/on-the-origins-of-the-2019-ncov-virus-wuhan-china
>  ?

Hmmm. Well I double-checked his results and the thing that doesn't  
make sense to me though is that the so-called insert (INS1378) is  
*LESS* related by sequence distance from the SARS spike-protein gene  
than the Wuhan coronavirus, SARS, and the bat coronavirsus that  
presumably spawned them both are from one another.

BLAST data excerpt:

Query: Wuhan seafood market pneumonia virus isolate  
2019-nCoV/USA-WA1-F6/2020, complete genome. Query ID: MT020881.1  
Length: 29882

SARS coronavirus HSZ-Bb, complete genome
Sequence ID: AY394985.1 Length: 29530
Range 1: 3030 to 27548

Score:22317 bits(24749), Expect:0.0,
Identities:19799/24663(80%),  Gaps:243/24663(0%), Strand: Plus/Plus

Query  3347    
TTTAGTGGTTATTTAAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAA  3406
               |||| |||||||||||||||||||||||||||   |||||||  ||  ||||| ||  |
Sbjct  3030    
TTTACTGGTTATTTAAAACTTACTGACAATGTTGCCATTAAATGTGTTGACATCGTTAAG  3089

. . .

While SARS and the nearest bat CoV is 83.44% identical by BLAST:
Query: Bat SARS-like coronavirus isolate bat-SL-CoVZC45, complete  
genome Query ID: MG772933.1 Length: 29802

SARS coronavirus HSZ-Bb, complete genome
Sequence ID: AY394985.1 Length: 29530
Range 1: 3024 to 21640

Score:19603 bits(21740), Expect:0.0,
Identities:15595/18691(83%),  Gaps:133/18691(0%), Strand: Plus/Plus

Query  3325    
AATAATTTCACAGGTTATTTAAAATTAACTGACAATGTCTTCATTAAAAATGCTGACATT  3384
               ||| | || || |||||||||||| | |||||||||||   |||||||  || ||||||
Sbjct  3024    
AATCAGTTTACTGGTTATTTAAAACTTACTGACAATGTTGCCATTAAATGTGTTGACATC  3083

. . .

And the Wuhan virus and that same bat virus are 88% identical:

Query: Bat SARS-like coronavirus isolate bat-SL-CoVZC45, complete  
genome Query ID: MG772933.1 Length: 29802

Wuhan seafood market pneumonia virus isolate  
2019-nCoV/USA-WA1-F6/2020, complete genome
Sequence ID: MT020881.1 Length: 29882
Range 1: 6 to 22872

Score:28811 bits(31952), Expect:0.0,
Identities:20145/22895(88%),  Gaps:82/22895(0%), Strand: Plus/Plus

Query  6      AGGTTTTTACCTTCCCAGGTAACAAACCAACTAACTCTCGATCTCTTGTAGATCTGTTCT  65
               |||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||
Sbjct  6      AGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCT  65

. . .


So lets summarize the above data: the overall genome-wide pairwise  
sequence identity between the three viruses are Wuhan<->SARS = 80%,  
Wuhan<->Bat-CoV = 88%, and SARS<->Bat CoV = 83%.

Meanwhile, the sequence identity between his alleged vaccine insert  
sequence (INS1378) and SARS is 67.94%

Query: INS1378 from
https://jameslyonsweiler.com/wp-content/uploads/2020/01/inserted-portion.txt


Query ID: lcl|Query_26509 Length: 1378

SARS coronavirus HSZ-Bb, complete genome
Sequence ID: AY394985.1 Length: 29530
Range 1: 21466 to 22608

Score:399 bits(442), Expect:2e-113,
Identities:803/1182(68%),  Gaps:48/1182(4%), Strand: Plus/Plus

Query  100     
GTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTC  159
               |||||| ||||||||| |||| ||||| |||||| ||||||||||| |||| ||||| ||
Sbjct  21466   
GTTTGACAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATC  21525


So his evidence that the Wuhan coronavirus was derived from a SARS  
vaccine is that the sequence coding for a modified spike-protein  
presumably from the vaccine is *LESS* similar to the naturally  
occurring SARS virus spike protein than the entire SARS virus, the  
Wuhan coronavirus, and the bat coronavirus are to one another on a  
genome-wide basis.

That is a little like accusing your brother of sleeping with your wife  
because your kid's eyes are a different color than yours, your  
brother's, or your wife's.

Furthermore, if the spike-protein from SARS that is only 72.88%  
similar to its corresponding sequence in the bat virus nonetheless  
arose naturally in SARS, then there is no reason to assume that the  
1378 bp insert that is 70.31% similar to its corresponding sequence in  
the bat virus did not naturally occur as well. The SARS virus was  
thought to have been passaged from bat to civet to human. So the Wuhan  
coronavirus was also likely passaged from bats through some food  
animal in the densely crowded live food market in Wuhan.

Stuart LaForge